adnp2a

Ensembl ID:
ENSDARG00000060937
ZFIN ID:
ZDB-GENE-040914-55
Description:
ADNP homeobox 2a [Source:RefSeq peptide;Acc:NP_001091735]
Human Orthologue:
ADNP2
Human Description:
ADNP homeobox 2 [Source:HGNC Symbol;Acc:23803]
Mouse Orthologue:
Adnp2
Mouse Description:
ADNP homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2448562]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36136 Nonsense Available for shipment Available now
sa22842 Nonsense Available for shipment Available now
sa15006 Nonsense Available for shipment Available now
sa22841 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 138 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27616046)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25461733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGAACAACACATTCAGTTTTTCCACATGCTGCCATCAAGAGCCCAT[C/T]AGAGCCACCCTAGCCACACTTTGGCCCACACACCGAAAACCATATCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 429 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27615173)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25460860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGTGTACGTTCACCATTTCTTGTTACTCAAGGTCTTCAGCTGAAC[C/T]AGTCGGTTCCAAGAGCTCCCCTCATCACCTCGCAGTCTGTGCGTCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 519 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27614902)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25460589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAATAAAAATTCCAGAYCAAATGAACTTGCTGTGCAGGCGCCRTTTT[T/A]RAAAAAACAKGATAAKCAAACTGTCAAGTGCCTGAGGTGCAAGATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 846 962 4 4
Genomic Location (Zv9):
Chromosome 16 (position 27613922)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25459609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCCGTTTGTGGATAAACAAGGCGGACGTGAAGGCGCACTTCAACAGC[A/T]AGCTCACTAAGTGCTTGAAAGCGATTCAGAAAAAGAGGGTTTGCGTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link