adnp2a

Ensembl ID:
ENSDARG00000060937
ZFIN ID:
ZDB-GENE-040914-55
Description:
ADNP homeobox 2a [Source:RefSeq peptide;Acc:NP_001091735]
Human Orthologue:
ADNP2
Human Description:
ADNP homeobox 2 [Source:HGNC Symbol;Acc:23803]
Mouse Orthologue:
Adnp2
Mouse Description:
ADNP homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2448562]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2880 Nonsense Mutation detected in F1 DNA During 2014
sa22842 Nonsense Mutation detected in F1 DNA During 2014
sa15006 Nonsense Available for shipment Available now
sa22841 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 177 962 4 4
Genomic Location:
Chromosome 16 (position 27615928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGACGACAGATACACTTGCGCGACCTGTGGTTATCATGACTCTTTAT[T/A]GTATGTGATGAAGAAGCACGTCCTGGTAAACCACTTTGCTACGTTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 429 962 4 4
Genomic Location:
Chromosome 16 (position 27615173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGTGTACGTTCACCATTTCTTGTTACTCAAGGTCTTCAGCTGAAC[C/T]AGTCGGTTCCAAGAGCTCCCCTCATCACCTCGCAGTCTGTGCGTCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 519 962 4 4
Genomic Location:
Chromosome 16 (position 27614902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAATAAAAATTCCAGAYCAAATGAACTTGCTGTGCAGGCGCCRTTTT[T/A]RAAAAAACAKGATAAKCAAACTGTCAAGTGCCTGAGGTGCAAGATTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086375 Nonsense 846 962 4 4
Genomic Location:
Chromosome 16 (position 27613922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCCGTTTGTGGATAAACAAGGCGGACGTGAAGGCGCACTTCAACAGC[A/T]AGCTCACTAAGTGCTTGAAAGCGATTCAGAAAAAGAGGGTTTGCGTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nr6p5ia9