si:dkey-205o12.6

Ensembl ID:
ENSDARG00000060933
ZFIN ID:
ZDB-GENE-060503-339
Description:
Brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 2 [Source:UniProtKB/Swiss-
Human Orthologue:
BAIAP2L2
Human Description:
BAI1-associated protein 2-like 2 [Source:HGNC Symbol;Acc:26203]
Mouse Orthologue:
Baiap2l2
Mouse Description:
BAI1-associated protein 2-like 2 Gene [Source:MGI Symbol;Acc:MGI:2652819]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31074 Nonsense Mutation detected in F1 DNA During 2017
sa29819 Nonsense Mutation detected in F1 DNA During 2017
sa13394 Nonsense Available for shipment Available now
sa24197 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086356 Nonsense 26 436 2 16
ENSDART00000143811 Nonsense 27 498 2 13
Genomic Location (Zv9):
Chromosome 22 (position 31711738)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29190816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACGCATGAATAAACACTATTTTTCTGTTTTTCTCCTCATCAAAGCGT[T/A]GGCTCTGACAAGCGAAGCCTACTTCAGCGCTCTTGCTAAGATGGGCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086356 Nonsense 84 436 4 16
ENSDART00000143811 Nonsense 85 498 4 13
Genomic Location (Zv9):
Chromosome 22 (position 31722417)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29201495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGTCTTGATTACTGTTTCAGTTCCGCTGGTTCCATGTGGAGGTTCTG[C/T]AGGCCATGGACAAGAACGTGAAGCTGGACGAGGAATACATTGAGGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086356   None 436 None 16
ENSDART00000143811 Nonsense 126 498 5 13
Genomic Location (Zv9):
Chromosome 22 (position 31722623)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29201701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGAATCAGGCGGCATCGCTGGAGCGTCAGCTGAGACGTGGTGCSTTC[A/T]GAGACTCACTGGTAAGACCACGTTTTTGTTCATGTAAACATTTTTAWGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086356   None 436 None 16
ENSDART00000143811 Nonsense 411 498 11 13
Genomic Location (Zv9):
Chromosome 22 (position 31732907)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29211985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCCTGCTCCAGCCACACAGCTGCGCCGTGGCTCGGCCGATGTTCGCT[C/A]GATATCTCCTCTCCCTGACAGGAGGGCGGAGTCTCATTTTGAGAGCAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link