si:ch211-136a13.1

Ensembl ID:
ENSDARG00000060927
ZFIN ID:
ZDB-GENE-050419-214
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVK0]
Human Orthologue:
HHIPL1
Human Description:
HHIP-like 1 [Source:HGNC Symbol;Acc:19710]
Mouse Orthologue:
Hhipl1
Mouse Description:
hedgehog interacting protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919265]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13578 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086350 Nonsense 592 866 6 9
ENSDART00000135026 Nonsense 524 788 6 9
Genomic Location (Zv9):
Chromosome 18 (position 48093520)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 49247281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGACAAAACCTGCAGTTTCCCCAAGCTCATAAACAGCTACTACAAGTA[C/A]ATTATATCATTCGGTGAAGACGAGGCCGGTAATATGGGATGGGATCAYTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link