jarid2a

Ensembl ID:
ENSDARG00000060925
ZFIN ID:
ZDB-GENE-061218-1
Human Orthologue:
JARID2
Human Description:
jumonji, AT rich interactive domain 2 [Source:HGNC Symbol;Acc:6196]
Mouse Orthologue:
Jarid2
Mouse Description:
jumonji, AT rich interactive domain 2 Gene [Source:MGI Symbol;Acc:MGI:104813]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16122 Essential Splice Site Available for shipment Available now
sa22844 Nonsense Mutation detected in F1 DNA During 2014
sa16781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086333 Essential Splice Site 105 1171 3 18
Genomic Location:
Chromosome 16 (position 27685084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGAGCGCAACCATGAGTTCTCTATGGACGGGCCTGCCAGGAAGAAG[T/C]GAGTTTACTTAGACCTGCACTTTATTGTGGTTTTGTGTCATTCTGTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086333 Nonsense 374 1171 7 18
Genomic Location:
Chromosome 16 (position 27716698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGCTCAGTGGGACAGACACTTTCCCCCCGAGACGAAACGGACTTCGG[C/T]AGTCAAAGAGGCAGCTGGAGTTAGCCGGAGCAGAGGTCGAGGTGAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086333 Nonsense 840 1171 11 18
Genomic Location:
Chromosome 16 (position 27732001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCATGGATGGAATCTTAATGTCCTTTCCAATAACTCAGGATCCATCT[T/A]ACGTCATCTTGGTGCTGTGCCAGGTAACATTTCAACCATTTCCTGAGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
  • Ovarian reserve: Genetic variants and environmental factors associated with hormonal markers of ovarian reserve in Caucasian and African American women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m4djmban