dgcr14

Ensembl ID:
ENSDARG00000060922
ZFIN ID:
ZDB-GENE-030131-2843
Description:
protein DGCR14 [Source:RefSeq peptide;Acc:NP_001082799]
Human Orthologue:
DGCR14
Human Description:
DiGeorge syndrome critical region gene 14 [Source:HGNC Symbol;Acc:16817]
Mouse Orthologue:
Dgcr14
Mouse Description:
DiGeorge syndrome critical region gene 14 Gene [Source:MGI Symbol;Acc:MGI:107854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38812 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086335 Nonsense 211 469 5 11
ENSDART00000132976 Nonsense 211 469 5 10
Genomic Location (Zv9):
Chromosome 10 (position 43466643)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42273138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCGGAGAAACAGGCTCTGGAGTGCACCAAAGCAGGACTGGAAACATG[G/A]CAGTACAAGGCCAAAAATTCACTGATGTATTATCCTGAAGGTAAAGCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link