pla2g6

Ensembl ID:
ENSDARG00000060921
ZFIN ID:
ZDB-GENE-040426-2079
Description:
85 kDa calcium-independent phospholipase A2 [Source:RefSeq peptide;Acc:NP_998262]
Human Orthologue:
PLA2G6
Human Description:
phospholipase A2, group VI (cytosolic, calcium-independent) [Source:HGNC Symbol;Acc:9039]
Mouse Orthologue:
Pla2g6
Mouse Description:
phospholipase A2, group VI Gene [Source:MGI Symbol;Acc:MGI:1859152]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29818 Nonsense Mutation detected in F1 DNA During 2017
sa43871 Nonsense Mutation detected in F1 DNA During 2017
sa3189 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa29818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044559 Nonsense 316 818 6 17
ENSDART00000086336 Nonsense 319 757 6 15
Genomic Location (Zv9):
Chromosome 22 (position 31668980)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29148058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCTTCTGCTGGACAGAGGATGCAACGTCAACTACTTGAGCAAGACT[G/T]GAGAAAGTCCTTTACACATCCTGACCAAGAGAGGGCGCTTTGAGGCCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044559 Nonsense 406 818 8 17
ENSDART00000086336   None 757 None 15
Genomic Location (Zv9):
Chromosome 22 (position 31679149)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29158227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTCCGACTGAAGGCTCCAACCGTAAGGTGCTGTTGAACATGCTGTG[T/A]AGTGTAGGTGTCGAACGCTGCCATCCTCCATCCCTCAACAGCCCTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3189
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044559 Nonsense 589 818 12 17
ENSDART00000086336 Nonsense 553 757 11 15
Genomic Location (Zv9):
Chromosome 22 (position 31690421)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29169499
KASP Assay ID:
554-3303.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTTCTTGCAGACAGACACCCTGGAGAACTGCATCTGTTTCGCAATTA[C/A]GACCCGCCGGCCCTTCAGAGAGACCCTCCATACAAGTCTACRGCCACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cutaneous nevi: Genome-wide association study identifies nidogen 1 (NID1) as a susceptibility locus to cutaneous nevi and melanoma risk. (View Study)
  • Cutaneous nevi: Genome-wide association study identifies variants at 9p21 and 22q13 associated with development of cutaneous nevi. (View Study)
  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link