FBXL16

Ensembl ID:
ENSDARG00000060915
Description:
F-box and leucine-rich repeat protein 16 [Source:HGNC Symbol;Acc:14150]
Human Orthologue:
FBXL16
Human Description:
F-box and leucine-rich repeat protein 16 [Source:HGNC Symbol;Acc:14150]
Mouse Orthologue:
Fbxl16
Mouse Description:
F-box and leucine-rich repeat protein 16 Gene [Source:MGI Symbol;Acc:MGI:2448488]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33183 Nonsense Mutation detected in F1 DNA During 2016
sa1026 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa33183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086324 Nonsense 262 505 2 5
Genomic Location:
Chromosome 3 (position 28792124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAATGCACCTTGAACTCTCCGGCTGCAATGACTTCACAGAAGCCGGCT[T/A]GTGGTCCAGCCTGAACGCGCGGCTTACCTCGCTCAGCGTCAGCGACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1026
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086324 Nonsense 496 505 5 5
Genomic Location:
Chromosome 3 (position 28786200)
KASP Assay ID:
554-0930.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGACCAACTGCCCGGGCGCCACYGCCGAACTCTTCAAATACTACTCC[C/T]AACATCTGCCACGCTGCATGGTCATCGAGTAGAGCAAAACGAGTTTTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link