LOC799259

Ensembl ID:
ENSDARG00000060912
Human Orthologue:
SLC5A7
Human Description:
solute carrier family 5 (choline transporter), member 7 [Source:HGNC Symbol;Acc:14025]
Mouse Orthologue:
Slc5a7
Mouse Description:
solute carrier family 5 (choline transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:1927126]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34534 Nonsense Mutation detected in F1 DNA During 2016
sa21408 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21409 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086304 Nonsense 144 585 3 8
Genomic Location (Zv9):
Chromosome 9 (position 309698)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 149360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATGGGCGGCCTGCTGTTCATCCCCGCGCTGCTGGGGGAGATCTTCTG[G/A]TCGGCTGCCATACTGTCTGCCCTGGGTAAGAGCCTGCCGGCGGGGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086304 Essential Splice Site 374 585 8 8
Genomic Location (Zv9):
Chromosome 9 (position 313390)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 145670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGTCAGGTTTGTCCTCCAGCCTAATGGATTCTTCTGTTTTCTGTGC[A/C]GGCGTCAGACCGAGAGATCGTGTGGGTCATGCGGATCACCATCTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086304 Nonsense 437 585 8 8
Genomic Location (Zv9):
Chromosome 9 (position 313582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 145478
GRCz10 9 162588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGCTGCTCAGTGTGCTGTTCATCAAGGGCACGAACACCTATGGCT[C/A]GGTGGCCGGTTACGTCTTCGGCCTGCTGCTGAGGATCGGCGGGGGCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link