
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC799259
- Ensembl ID:
- ENSDARG00000060912
- Human Orthologue:
- SLC5A7
- Human Description:
- solute carrier family 5 (choline transporter), member 7 [Source:HGNC Symbol;Acc:14025]
- Mouse Orthologue:
- Slc5a7
- Mouse Description:
- solute carrier family 5 (choline transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:1927126]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34534 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21408 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa21409 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34534
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086304 | Nonsense | 144 | 585 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 9 (position 309698)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 149360 GRCz11 9 127929 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCATGGGCGGCCTGCTGTTCATCCCCGCGCTGCTGGGGGAGATCTTCTG[G/A]TCGGCTGCCATACTGTCTGCCCTGGGTAAGAGCCTGCCGGCGGGGGGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21408
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086304 | Essential Splice Site | 374 | 585 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 9 (position 313390)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 145670 GRCz11 9 124239 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGAAGTCAGGTTTGTCCTCCAGCCTAATGGATTCTTCTGTTTTCTGTGC[A/C]GGCGTCAGACCGAGAGATCGTGTGGGTCATGCGGATCACCATCTTTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21409
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000086304 | Nonsense | 437 | 585 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 9 (position 313582)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 145478 GRCz10 9 162588 GRCz11 9 124047 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCTCAGCTGCTCAGTGTGCTGTTCATCAAGGGCACGAACACCTATGGCT[C/A]GGTGGCCGGTTACGTCTTCGGCCTGCTGCTGAGGATCGGCGGGGGCGAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: