si:ch211-126i22.5

Ensembl ID:
ENSDARG00000060911
ZFIN ID:
ZDB-GENE-091204-183
Human Orthologue:
KIAA1958
Human Description:
KIAA1958 [Source:HGNC Symbol;Acc:23427]
Mouse Orthologue:
E130308A19Rik
Mouse Description:
RIKEN cDNA E130308A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442164]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31767 Nonsense Available for shipment Available now
sa41601 Nonsense Mutation detected in F1 DNA During 2017
sa31768 Nonsense Available for shipment Available now
sa8533 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269   None 652 None 12
ENSDART00000135355 Nonsense 328 883 2 7
ENSDART00000143615 Nonsense 226 266 1 3
ENSDART00000145673   None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11253495)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11329361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGGCTTCGATTGGCGCAAACCCAGAAATGGATCTTCTATCTGCA[C/T]AGGCACTTAGTACAGAAGCGAGAGCAGACAACACAGGTAAAGAGCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 Nonsense 318 652 12 12
ENSDART00000135355 Nonsense 549 883 7 7
ENSDART00000143615   None 266 None 3
ENSDART00000145673   None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11277231)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11353097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCCCTTCTTCCCTTTCAGCAGACATGGATGAGAGAGCGTATCCAGAA[C/T]AGAACGAGAAGACGATTCGCAGCACCCAAACAGCTCTCCGCAACTTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 Nonsense 344 652 12 12
ENSDART00000135355 Nonsense 575 883 7 7
ENSDART00000143615   None 266 None 3
ENSDART00000145673   None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11277309)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11353175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGCTCTCCGCAACTTTCGGGATTTCCTGGTTTCAAAGTATCCAAAC[G/T]AGACCAGAGAAATTTACAACATCCCCTGCCACGAGTTAGACATCTACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086269 Nonsense 405 652 12 12
ENSDART00000135355 Nonsense 636 883 7 7
ENSDART00000143615   None 266 None 3
ENSDART00000145673   None 131 None 2
Genomic Location (Zv9):
Chromosome 10 (position 11277492)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11353358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCTATCTGAAGGAGCATCGGTATGCCTACAGTWTTACAAGAGACCGC[G/T]AGTTCCAGAGATCCCAGGATGCCCTCAAGCAAAAGCAACTGGAGCTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link