edil3b

Ensembl ID:
ENSDARG00000060877
ZFIN ID:
ZDB-GENE-090312-42
Human Orthologues:
EDIL3, F8
Human Descriptions:
coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
EGF-like repeats and discoidin I-like domains 3 [Source:HGNC Symbol;Acc:3173]
Mouse Orthologue:
Edil3
Mouse Description:
EGF-like repeats and discoidin I-like domains 3 Gene [Source:MGI Symbol;Acc:MGI:1329025]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15447 Nonsense Available for shipment Available now
sa658 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa15447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 77 475 3 10
ENSDART00000142872 Nonsense 4 385 1 8
Genomic Location (Zv9):
Chromosome 10 (position 44870290)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43563878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTRGWTCTGAGATCNNNNTTTTTGTGCTTCAGGGCCCWGCCGGCCRAACCCGTG[T/A]CACARTGGAGGCCTGTGTGARCTTAATCAGACCGACCGCGGAGACRCYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa658
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 475 475 10 10
ENSDART00000142872   386 385 8 8
Genomic Location (Zv9):
Chromosome 10 (position 44833932)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43527520
KASP Assay ID:
554-0566.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATGGACGGATCACCGTACGGATGGAGCTGCTGGGATGTCCGGAGGAA[C/T]AGTGAAAAACATTTCTAACGCTGATCTCNNAAGGATGCTGACTCAAAAGCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link