edil3b

Ensembl ID:
ENSDARG00000060877
ZFIN ID:
ZDB-GENE-090312-42
Human Orthologues:
EDIL3, F8
Human Descriptions:
coagulation factor VIII, procoagulant component [Source:HGNC Symbol;Acc:3546]
EGF-like repeats and discoidin I-like domains 3 [Source:HGNC Symbol;Acc:3173]
Mouse Orthologue:
Edil3
Mouse Description:
EGF-like repeats and discoidin I-like domains 3 Gene [Source:MGI Symbol;Acc:MGI:1329025]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15447 Nonsense Available for shipment Available now
sa4395 Nonsense Mutation detected in F1 DNA During 2014
sa658 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa15447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 77 475 3 10
ENSDART00000142872 Nonsense 4 385 1 8
Genomic Location:
Chromosome 10 (position 44870290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTRGWTCTGAGATCNNNNTTTTTGTGCTTCAGGGCCCWGCCGGCCRAACCCGTG[T/A]CACARTGGAGGCCTGTGTGARCTTAATCAGACCGACCGCGGAGACRCYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 111 475 3 10
ENSDART00000142872 Nonsense 38 385 1 8
Genomic Location:
Chromosome 10 (position 44870190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGGGATATTTGTGCAGGTGTCCGGCTGGATTCAACGGGGTTCACTGC[C/T]AACACAGTAAGAAACCTTTTTACWCACATTTTTACGCACAATTTTAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa658
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086227 Nonsense 475 475 10 10
ENSDART00000142872 None 386 385 8 8
Genomic Location:
Chromosome 10 (position 44833932)
KASP Assay ID:
554-0566.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATGGACGGATCACCGTACGGATGGAGCTGCTGGGATGTCCGGAGGAA[C/T]AGTGAAAAACATTTCTAACGCTGATCTCNNAAGGATGCTGACTCAAAAGCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e0qyhryw