si:ch73-169d9.1

Ensembl ID:
ENSDARG00000060875
ZFIN IDs:
ZDB-GENE-090831-2, ZDB-GENE-100922-7
Human Orthologue:
PDE1A
Human Description:
phosphodiesterase 1A, calmodulin-dependent [Source:HGNC Symbol;Acc:8774]
Mouse Orthologue:
Pde1a
Mouse Description:
phosphodiesterase 1A, calmodulin-dependent Gene [Source:MGI Symbol;Acc:MGI:1201792]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17187 Nonsense Available for shipment Available now
sa34755 Nonsense Mutation detected in F1 DNA During 2017
sa21590 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 27 611 1 15
ENSDART00000140689   None 139 None 4
Genomic Location (Zv9):
Chromosome 9 (position 45709273)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44840938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGAACTCTCTCAAGTACTCCAAGTGTGATCAGACGGAGAAGATGTG[G/A]ATTAGGCTGAAAGGAATGTAAGTGTTTTCTTATTTTTTTTTTTGTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 154 611 5 15
ENSDART00000140689 Nonsense 130 139 4 4
Genomic Location (Zv9):
Chromosome 9 (position 45601729)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44733394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTTGCAGAATGTACAGAAGAACATCCAACATGGCAGGGTTGACCTA[T/A]CCGCCATCTGTAATTACTGCTCTAAAGGTACAGATTATCTTCGCAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086202 Nonsense 606 611 15 15
ENSDART00000140689   None 139 None 4
Genomic Location (Zv9):
Chromosome 9 (position 45564702)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44696458
KASP Assay ID:
2260-2462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCCGGAGATGCTTCCCCGGAGGAGCACAGCTCAGAAACGCTGCCCTG[G/A]AACGGCAAGAGCGCCTGAATCTTTGCAGTCACAAATGGGACGATGTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link