LOC568340

Ensembl ID:
ENSDARG00000060868
Human Orthologue:
MBTD1
Human Description:
mbt domain containing 1 [Source:HGNC Symbol;Acc:19866]
Mouse Orthologue:
Mbtd1
Mouse Description:
mbt domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2143977]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4474 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2643 Nonsense F2 line generated During 2014
sa22144 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Essential Splice Site 75 705 2 17
Genomic Location:
Chromosome 12 (position 35052394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAACAATGGCCAGGTGTACACCTATCCTGACGGRAAAGCAGGAATGGG[T/C]TAGTCATGTGGATACAAAAGTCAAAAAACATACCTAAATATTATTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2643
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Nonsense 150 705 4 17
Genomic Location:
Chromosome 12 (position 35049446)
KASP Assay ID:
554-2918.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGTTAATGGCAAAGTTGGCAGCTTATGCACAGTATCAAGCAAGTCAA[C/T]AGAACCAAGCTAAATCAAAATCAGGTAAAATGGCTTATTTTAGTGTTNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086087 Essential Splice Site 158 705 4 17
Genomic Location:
Chromosome 12 (position 35049420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCACAGTATCAAGCAAGTCAACAGAACCAAGCTAAATCAAAATCAGG[T/C]AAAATGGCTTATTTTAGTGTTGTTATGTAATTATATGCCTGAATGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lv47b7ep