scai

Ensembl ID:
ENSDARG00000060865
ZFIN ID:
ZDB-GENE-060526-57
Description:
Novel protein similar to human chromosome 9 open reading frame 126 (C9orf126) [Source:UniProtKB/TrEM
Human Orthologue:
SCAI
Human Description:
suppressor of cancer cell invasion [Source:HGNC Symbol;Acc:26709]
Mouse Orthologue:
Scai
Mouse Description:
suppressor of cancer cell invasion Gene [Source:MGI Symbol;Acc:MGI:2443716]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40471 Nonsense Mutation detected in F1 DNA During 2017
sa40472 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086195 Nonsense 400 565 12 16
ENSDART00000139744 Nonsense 400 565 13 17
Genomic Location (Zv9):
Chromosome 5 (position 33677167)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31439399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGGAAACCTCTGTTTATCATTGTCGACTCCTCCAACAGCACAGCTTA[T/A]AAGGTGAGACTTCAGCTCTCCATCGCCTTTCTTTTCTGTCACACGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086195 Nonsense 542 565 16 16
ENSDART00000139744 Nonsense 542 565 17 17
Genomic Location (Zv9):
Chromosome 5 (position 33683838)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31446070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTATCCCCCTCTGCCAAAACAGGAGATGGTGGAGAGCAGCCTTCTACAG[A/T]AACATGTGCTGGAGCTGGCGGCTATGCTGGACGTGCAAAACCTCTTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link