nckap1

Ensembl ID:
ENSDARG00000060853
ZFIN ID:
ZDB-GENE-030131-4426
Description:
Nck-associated protein 1 [Source:UniProtKB/Swiss-Prot;Acc:B0S6R1]
Human Orthologue:
NCKAP1
Human Description:
NCK-associated protein 1 [Source:HGNC Symbol;Acc:7666]
Mouse Orthologue:
Nckap1
Mouse Description:
NCK-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1355333]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41545 Nonsense Mutation detected in F1 DNA During 2017
sa30927 Nonsense Mutation detected in F1 DNA During 2017
sa11335 Nonsense Available for shipment Available now
sa44713 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34756 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086176 Nonsense 556 1124 16 30
ENSDART00000132696 Nonsense 558 1128 16 30
ENSDART00000145271   None 245 None 7
ENSDART00000086176 Nonsense 556 1124 16 30
ENSDART00000132696 Nonsense 558 1128 16 30
ENSDART00000145271   None 245 None 7
Genomic Location (Zv9):
Chromosome 9 (position 45846237)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44977902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATAGTTTTTACAGCCGCGCCTTTGAAAAGATGTTCCAGCAGTGTCTT[G/T]AACTGCCGTCCCAGTCTCGATACTCCATCTCCTTCCCACTGCTCTGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086176 Nonsense 556 1124 16 30
ENSDART00000132696 Nonsense 558 1128 16 30
ENSDART00000145271   None 245 None 7
ENSDART00000086176 Nonsense 556 1124 16 30
ENSDART00000132696 Nonsense 558 1128 16 30
ENSDART00000145271   None 245 None 7
Genomic Location (Zv9):
Chromosome 9 (position 45846237)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44977902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATAGTTTTTACAGCCGCGCCTTTGAAAAGATGTTCCAGCAGTGTCTT[G/T]AACTGCCGTCCCAGTCTCGATACTCCATCTCCTTCCCACTGCTCTGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086176 Nonsense 689 1124 19 30
ENSDART00000132696 Nonsense 691 1128 19 30
ENSDART00000145271   None 245 None 7
Genomic Location (Zv9):
Chromosome 9 (position 45860060)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44991725
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATAAACTGCACACTGCTCTGTCCGAGCTCTGCTTCTCCATMAACTA[C/A]GTCCCCAACATGATGGTCTGGGAGCACACCTTCACCCCACGCGAGTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086176 Essential Splice Site 896 1124 23 30
ENSDART00000132696 Essential Splice Site 898 1128 23 30
ENSDART00000145271   None 245 None 7
Genomic Location (Zv9):
Chromosome 9 (position 45874495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTTGACAAGCCGGACCATATGGCAGCACTCTTTAAGAGGCTAACAT[G/A]TGAGTATCTGTTGTGGGATTTTTTAGTGATATATTTTTATGGCATTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086176 Essential Splice Site 951 1124 25 30
ENSDART00000132696 Essential Splice Site 953 1128 25 30
ENSDART00000145271   None 245 None 7
Genomic Location (Zv9):
Chromosome 9 (position 45881673)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45013338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGTTGAAGACTTTAAAGATCACATTCCTCGTGAAACTGACATGAAGG[T/A]AAGTGGAGTTCAGACTTGCTGGTAACAGTAACAATGGGGAAACAGCCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link