dlgap4

Ensembl ID:
ENSDARG00000060849
ZFIN ID:
ZDB-GENE-080219-51
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B1H1I3]
Human Orthologue:
DLGAP4
Human Description:
discs, large (Drosophila) homolog-associated protein 4 [Source:HGNC Symbol;Acc:24476]
Mouse Orthologue:
Dlgap4
Mouse Description:
discs, large homolog-associated protein 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2138865]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3212 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3212
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086156 Nonsense 41 340 3 7
Genomic Location (Zv9):
Chromosome 23 (position 43222339)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42958891
KASP Assay ID:
554-2473.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTTTGTGCTTCAGGTGGATTGTGTGCAGCCGATTCTGAAGGAGGAA[C/T]AAACCCCCACCACCAGGTTCCAGTCCATCGGGGTTCAGGTTGAAGACGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link