si:ch211-134j6.4

Ensembl ID:
ENSDARG00000060845
ZFIN ID:
ZDB-GENE-090313-28
Description:
Novel protein similar to H.sapiens ANTXR1, anthrax toxin receptor 1 (ANTXR1) [Source:UniProtKB/TrEMB
Human Orthologue:
ANTXR1
Human Description:
anthrax toxin receptor 1 [Source:HGNC Symbol;Acc:21014]
Mouse Orthologue:
Antxr1
Mouse Description:
anthrax toxin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1916788]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9907 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086143   None 524 None 18
ENSDART00000141786 Essential Splice Site None 270 1 13
ENSDART00000143308   None 199 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31520729)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31166677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTTTGGAGAGAATAAACTGMTGAAATGGCACGTTCACTGATTCACG[T/A]GAGTCTTGTGTGCATTTTACTGATTTTTACGGCCAGTCTTCAAACTGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link