si:ch1073-352h10.2

Ensembl ID:
ENSDARG00000060838
ZFIN ID:
ZDB-GENE-081031-1
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19306 Nonsense Mutation detected in F1 DNA During 2017
sa29835 Nonsense Mutation detected in F1 DNA Unknown

Mutation Details

Allele Name:
sa19306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086144 Nonsense 380 453 6 7
ENSDART00000146662 Nonsense 380 453 6 7
ENSDART00000086144 Nonsense 380 453 6 7
ENSDART00000146662 Nonsense 380 453 6 7
Genomic Location (Zv9):
Chromosome 22 (position 39595869)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36744619
KASP Assay ID:
554-6172.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCAGAGGAAGGGAGGGGGTTTCTTTAACTCTGATGTCTGGAGTGTGT[C/A]GTATGACCCTGATAAACTGTTTGAGTCTGGTTTTCATGTTGATCAGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086144 Nonsense 380 453 6 7
ENSDART00000146662 Nonsense 380 453 6 7
ENSDART00000086144 Nonsense 380 453 6 7
ENSDART00000146662 Nonsense 380 453 6 7
Genomic Location (Zv9):
Chromosome 22 (position 39595869)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36744619
KASP Assay ID:
554-6172.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCAGAGGAAGGGAGGGGGTTTCTTTAACTCTGATGTCTGGAGTGTGT[C/A]GTATGACCCTGATAAACTGTTTGAGTCTGGTTTTCATGTTGATCAGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link