tecpr2

Ensembl ID:
ENSDARG00000060835
ZFIN ID:
ZDB-GENE-060503-358
Description:
tectonin beta-propeller repeat-containing protein 2 [Source:RefSeq peptide;Acc:NP_001038644]
Human Orthologue:
TECPR2
Human Description:
tectonin beta-propeller repeat containing 2 [Source:HGNC Symbol;Acc:19957]
Mouse Orthologue:
Tecpr2
Mouse Description:
tectonin beta-propeller repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:2144865]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3989 Nonsense Mutation detected in F1 DNA During 2014
sa10589 Nonsense Available for shipment Available now
sa15119 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 180 1358 4 19
ENSDART00000133668 Nonsense 180 1308 4 19
ENSDART00000133971 None None 978 None 13
Genomic Location:
Chromosome 17 (position 29369735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCAGTGGTCCTCTTCGAAGAGCCTTCAGCAATAGTACAGTTAGAATA[T/G]AGTCAAAAGGTACTTCTGGTTTCATCCTATCAACGYTCAWTGCTTTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 740 1358 8 19
ENSDART00000133668 Nonsense 690 1308 8 19
ENSDART00000133971 Nonsense 360 978 2 13
Genomic Location:
Chromosome 17 (position 29365327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGAGCTTGCAGAGCTCATCTGCTGAGCAGAAGGAGGATGAAGAGACA[C/T]AGCTCCTCAAAGCTGACCAGGTCAGAGAGCATATCCRATTARGAGACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104224 Nonsense 1216 1358 17 19
ENSDART00000133668 Nonsense 1166 1308 17 19
ENSDART00000133971 Nonsense 836 978 11 13
Genomic Location:
Chromosome 17 (position 29347245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGYTTTTCTTTTYCTGATGTTTWCTTTGAGCAGCCTGCWGGACAYTA[T/A]TTGGTGAAGAYTCAGACCAGTCCTAATGACCGCATGCTGTGGGCACTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r7l2ruyo