si:ch211-265m20.6

Ensembl ID:
ENSDARG00000060829
ZFIN ID:
ZDB-GENE-091204-152
Description:
carbonic anhydrase like [Source:RefSeq peptide;Acc:NP_001038604]
Mouse Orthologue:
Car15
Mouse Description:
carbonic anhydrase 15 Gene [Source:MGI Symbol;Acc:MGI:1931324]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16188 Essential Splice Site Available for shipment Available now
sa14976 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086119 Essential Splice Site 35 255 2 7
ENSDART00000144919 Essential Splice Site 29 284 2 8
Genomic Location (Zv9):
Chromosome 10 (position 43402073)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42208568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATTTGAATATTTGTCCTCAGACTTTTGTTATGACGAGGACCACTGTG[G/A]WGAGTTCATGAGCGAAAGCAATCATGCGTTATTCAAACATGCTATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086119 Essential Splice Site 36 255 2 7
ENSDART00000144919 Essential Splice Site 30 284 2 8
Genomic Location (Zv9):
Chromosome 10 (position 43402072)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42208567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTGAATATTTGTCCTCAGACTTTTGTTATGACGAGGACCACTGTGR[T/A]GAGTTCATGAGCGAAAGCAATCATGCGTTATTCAAACATGCTATTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link