plekha7

Ensembl ID:
ENSDARG00000060813
ZFIN ID:
ZDB-GENE-050419-75
Description:
Pleckstrin homology domain-containing family A member 7 [Source:UniProtKB/Swiss-Prot;Acc:B6RSP1]
Human Orthologue:
PLEKHA7
Human Description:
pleckstrin homology domain containing, family A member 7 [Source:HGNC Symbol;Acc:27049]
Mouse Orthologue:
Plekha7
Mouse Description:
pleckstrin homology domain containing, family A member 7 Gene [Source:MGI Symbol;Acc:MGI:2445094]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23317 Essential Splice Site Available for shipment Available now
sa29048 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43121 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6523 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086094 Essential Splice Site 28 1208 1 27
ENSDART00000111450   None 1075 None 22
ENSDART00000140444   None 110 None 4
Genomic Location (Zv9):
Chromosome 18 (position 27045979)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27119234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAACGGCTCTTATGGAGTGTGCAGAGACGGCAGGGTCTTTTTCATTGA[G/A]TGAGGATATATTTATTTACTCTTGCCTAAGAAAGCATTCCTTTCTCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086094 Essential Splice Site 73 1208 3 27
ENSDART00000111450   None 1075 None 22
ENSDART00000140444   None 110 None 4
Genomic Location (Zv9):
Chromosome 18 (position 27046350)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27119605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGTTGGGAGGAAGGTTTTACGAAAGAAGGAGCGAGTTTTTTTATTGA[G/A]TAAGTGGATGTGTTTATTGTAATTATACCTTATGCGATCCTGTAGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086094 Essential Splice Site 133 1208 5 27
ENSDART00000111450   None 1075 None 22
ENSDART00000140444   None 110 None 4
Genomic Location (Zv9):
Chromosome 18 (position 27156464)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27229719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACTACTGTCACCACCTCAACTGTGGACAGCACTTCAGGCTCAAAG[G/A]TCAGTAACAAAAAGAAATTGTAATATTTTAGGATTTATAAAGTATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086094 Essential Splice Site 422 1208 10 27
ENSDART00000111450 Essential Splice Site 289 1075 5 22
ENSDART00000140444   None 110 None 4
Genomic Location (Zv9):
Chromosome 18 (position 27197138)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27270393
KASP Assay ID:
554-4734.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCAGGTGGAGAACTGGGTGAAAGTACAGAAGGAGGAACGCCACGGG[T/C]GAGTCTGCAGACGCATATGGATGTGAACATACATCTGTCACACACATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link