mecom

Ensembl ID:
ENSDARG00000060808
ZFIN IDs:
ZDB-GENE-050208-123, ZDB-GENE-050208-123
Description:
Ecotropic viral integration site 1 [Source:UniProtKB/TrEMBL;Acc:A5HML2]
Human Orthologue:
MECOM
Human Description:
MDS1 and EVI1 complex locus [Source:HGNC Symbol;Acc:3498]
Mouse Orthologue:
Mecom
Mouse Description:
MDS1 and EVI1 complex locus Gene [Source:MGI Symbol;Acc:MGI:95457]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24992 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa42598 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086051 Missense 266 602 2 7
ENSDART00000128996 Essential Splice Site 432 1042 None 15
Genomic Location:
Chromosome 15 (position 34665737)
KASP Assay ID:
554-7421.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGCGAGTGCGGGAGAACGGAAAAGGACCAAAAAGGAAGTCCAGCGGG[T/C]TCAATGATGCCCAGAGTCCAACTCTTGTTAGCTCCAGTAGTAGTAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086051   None 602 None 7
ENSDART00000128996 Nonsense 800 1042 11 15
Genomic Location:
Chromosome 15 (position 34647300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGAGAAACCCTTCAAATGCCACCTGTGCGACCGCTGCTTCGGGCAA[C/T]AGACCAACCTGGATCGGCATCTCAAAAAACACGAGAATGGTAATTTAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link