mecom

Ensembl ID:
ENSDARG00000060808
ZFIN IDs:
ZDB-GENE-050208-123, ZDB-GENE-050208-123
Description:
Ecotropic viral integration site 1 [Source:UniProtKB/TrEMBL;Acc:A5HML2]
Human Orthologue:
MECOM
Human Description:
MDS1 and EVI1 complex locus [Source:HGNC Symbol;Acc:3498]
Mouse Orthologue:
Mecom
Mouse Description:
MDS1 and EVI1 complex locus Gene [Source:MGI Symbol;Acc:MGI:95457]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24992 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086051 Missense 266 602 2 7
ENSDART00000128996 Essential Splice Site 432 1042 None 15
Genomic Location:
Chromosome 15 (position 34665737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGCGAGTGCGGGAGAACGGAAAAGGACCAAAAAGGAAGTCCAGCGGG[T/C]TCAATGATGCCCAGAGTCCAACTCTTGTTAGCTCCAGTAGTAGTAGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qvbw4i5r