mrpl22

Ensembl ID:
ENSDARG00000060798
ZFIN ID:
ZDB-GENE-080303-28
Description:
39S ribosomal protein L22, mitochondrial [Source:RefSeq peptide;Acc:NP_001116093]
Human Orthologue:
MRPL22
Human Description:
mitochondrial ribosomal protein L22 [Source:HGNC Symbol;Acc:14480]
Mouse Orthologue:
Mrpl22
Mouse Description:
mitochondrial ribosomal protein L22 Gene [Source:MGI Symbol;Acc:MGI:1333794]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3132 Essential Splice Site F2 line generated During 2014
sa9149 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19268 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3132
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086060 Essential Splice Site 91 209 4 7

The following transcripts of ENSDARG00000060798 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 35714388)
KASP Assay ID:
554-3368.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCAGATTAAATACAGTAAAGACAAGATGTGGTACTTGGCTAAATTGG[T/C]GAGTGATAAATATTTGTACAATGACTGTCACTTGGTAATGTGAAGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086060 Essential Splice Site 92 209 None 7

The following transcripts of ENSDARG00000060798 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 35714299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAAGATTGAATTAGSAGCCTGTCTCATATGTRATMAATCTGTTTTTC[A/T]GATCAGAGGTATGACCATTGACCAGGCACTYGTTCAGCTTRAGTTCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086060 Essential Splice Site 141 209 None 7

The following transcripts of ENSDARG00000060798 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 35712831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCAGTCAGGAATCACAATGTGGAATACAAGTCAAATCTATATATTGG[T/A]AAGTTGCAAAAATTACATCCACATTAGTATTTTTTATTGTCTTTACAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u26lc4fj