mrpl22

Ensembl ID:
ENSDARG00000060798
ZFIN ID:
ZDB-GENE-080303-28
Description:
39S ribosomal protein L22, mitochondrial [Source:RefSeq peptide;Acc:NP_001116093]
Human Orthologue:
MRPL22
Human Description:
mitochondrial ribosomal protein L22 [Source:HGNC Symbol;Acc:14480]
Mouse Orthologue:
Mrpl22
Mouse Description:
mitochondrial ribosomal protein L22 Gene [Source:MGI Symbol;Acc:MGI:1333794]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3132 Essential Splice Site F2 line generated During 2016
sa9149 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3132
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086060 Essential Splice Site 91 209 4 7

The following transcripts of ENSDARG00000060798 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 35714388)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36707636
KASP Assay ID:
554-3368.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCAGATTAAATACAGTAAAGACAAGATGTGGTACTTGGCTAAATTGG[T/C]GAGTGATAAATATTTGTACAATGACTGTCACTTGGTAATGTGAAGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086060 Essential Splice Site 92 209 None 7

The following transcripts of ENSDARG00000060798 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 35714299)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36707547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAAGATTGAATTAGSAGCCTGTCTCATATGTRATMAATCTGTTTTTC[A/T]GATCAGAGGTATGACCATTGACCAGGCACTYGTTCAGCTTRAGTTCAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link