pfkmb

Ensembl ID:
ENSDARG00000060797
ZFIN ID:
ZDB-GENE-081114-1
Description:
phosphofructokinase, muscle b [Source:RefSeq peptide;Acc:NP_001082886]
Human Orthologue:
PFKM
Human Description:
phosphofructokinase, muscle [Source:HGNC Symbol;Acc:8877]
Mouse Orthologue:
Pfkm
Mouse Description:
phosphofructokinase, muscle Gene [Source:MGI Symbol;Acc:MGI:97548]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31530 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085277 Essential Splice Site 397 776 12 22
ENSDART00000128374 Essential Splice Site 520 899 15 25
Genomic Location (Zv9):
Chromosome 6 (position 39680485)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39752085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGAACACATATAAACTCTTAGCCCATGTGACGGCCCCAGATGTGAAG[G/A]TTTGTATCATTCAGCCTTTCAGTTAAAGCCTTTTTTTAGACTCACATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link