PXN (3 of 3)

Ensembl ID:
ENSDARG00000060766
Description:
paxillin [Source:HGNC Symbol;Acc:9718]
Human Orthologue:
PXN
Human Description:
paxillin [Source:HGNC Symbol;Acc:9718]
Mouse Orthologue:
Pxn
Mouse Description:
paxillin Gene [Source:MGI Symbol;Acc:MGI:108295]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11930 Essential Splice Site Available for shipment Available now
sa34282 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa328 Nonsense Confirmed mutation in F2 line During 2017
sa17685 Nonsense Available for shipment Available now
sa17848 Nonsense Available for shipment Available now
sa11924 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085993 Essential Splice Site 47 1197 1 14
Genomic Location (Zv9):
Chromosome 8 (position 3681498)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3430027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRGGTGGGACTGAAWACTGGGASRCATTCTGGAATACTCTCTAAACTCTG[T/G]GAGTACTTGTTTTCTGGAAACATTACTGCATTGCGTGTTTGTGGTKAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085993 Splice Site, Nonsense 112 1197 2 14
Genomic Location (Zv9):
Chromosome 8 (position 3693176)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3440148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGCTGAAGCCCTGAACGGATCTCTCTCCCCACGGCCGGACTCACAA[C/T]AGGTTCAGCTCAAACTGCACTTTCACAATAAACTTAGATTCATAGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa328
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085993 Nonsense 261 1197 6 14
Genomic Location (Zv9):
Chromosome 8 (position 3697813)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3444784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTTAATTTATGTAAACAGACCCAGCCCATGTGCTTTGACAAGCAATT[T/A]GACTGACGGCCAGTTGGACGCACCTTCCGAGCAGCAGGGCAGAATTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085993 Nonsense 379 1197 7 14
Genomic Location (Zv9):
Chromosome 8 (position 3698665)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3445636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGGGGCTGTGCCTCTACCTTCCAATGGTGTATTTAAGTCTTACTCT[C/T]GACTGTCTCCCCCTCCAGCATCTAGTCCAYGTTTCTCTCCAGCGCCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085993 Nonsense 1012 1197 11 14
Genomic Location (Zv9):
Chromosome 8 (position 3708142)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3454720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGATTGGTTCCAGGAACTTCTTTGMGAGAGAAGGACAGCCATATTGC[G/T]AGAGGGATTATCACCATTWAWTCTCTCCAAGATGCTACTACTGTAACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085993 Nonsense 1018 1197 11 14
Genomic Location (Zv9):
Chromosome 8 (position 3708161)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3454739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTTGMGAGAGAAGGACAGCCATATTGCGAGAGGGATTATCACCATT[T/A]AWTCTCTCCAAGATGCTACTACTGTAACGGACCCATCCTGGAYGTGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link