nphs1l

Ensembl ID:
ENSDARG00000060758
ZFIN ID:
ZDB-GENE-051102-1
Description:
nephrin [Source:RefSeq peptide;Acc:NP_001035777]
Human Orthologue:
NPHS1
Human Description:
nephrosis 1, congenital, Finnish type (nephrin) [Source:HGNC Symbol;Acc:7908]
Mouse Orthologue:
Nphs1
Mouse Description:
nephrosis 1 homolog, nephrin (human) Gene [Source:MGI Symbol;Acc:MGI:1859637]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32057 Essential Splice Site Available for shipment Available now
sa42603 Nonsense Mutation detected in F1 DNA During 2017
sa6392 Nonsense Mutation detected in F1 DNA During 2017
sa22702 Essential Splice Site Available for shipment Available now
sa22701 Nonsense Available for shipment Available now
sa28513 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085971 Essential Splice Site 87 1242 3 29
Genomic Location (Zv9):
Chromosome 15 (position 35909506)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36835928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATAACAATTGTCCCATGTCCCTTTCTTTCCTCCTCATATTTCCCAAC[A/C]GGCCAGTACCACCTTCAGATTCTAGACGTGACATTAGAAGACGACGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085971 Nonsense 206 1242 6 29
Genomic Location (Zv9):
Chromosome 15 (position 35870468)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36793604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTTTCTCTTTTCCAGCATCAGGGCACGAAGCTCGGACGACACG[C/T]GACGCCTGACGTGTCGAGCGAAAAACCCTGCTTCACCTCGAGCTCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085971 Nonsense 680 1242 16 29
Genomic Location (Zv9):
Chromosome 15 (position 35823805)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36746941
KASP Assay ID:
554-5229.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTATCACGTCTCTTGTATGTGTTTGTGACAGAAAGAGATCCTCGTTA[T/G]ACCTTCAGTGACTGGACTCTTGAGATCGTGAACGTGTCTCGGCGGGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085971 Essential Splice Site 816 1242 19 29
Genomic Location (Zv9):
Chromosome 15 (position 35806781)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36729917
KASP Assay ID:
2260-8857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGAATCTGTCTAATGAATGAGTTTGAACCTGTTGTGTGTTCTTGCA[G/A]TTGCTCCAGATCTTCAGAAGGGGCCACAGTGGAGGAAAGTGGCCAGTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085971 Nonsense 949 1242 21 29
Genomic Location (Zv9):
Chromosome 15 (position 35798809)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36721945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACCAGACCTCCGTTACTCTGGAGTGGATGCCTGGATTTGACGGTGGTT[T/A]GACACAGATCTTCCGTGTCAGGTGAAGCTGTCATAAATGCCGCTGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085971 Nonsense 1030 1242 23 29
Genomic Location (Zv9):
Chromosome 15 (position 35789127)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36712263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCTCTCAGATGCGAAGGAAGCTGACGGCGGGGTCTCCACAGCGGAC[C/T]AGGACTCGGCTCTTGCAGGTGCTGCATTTCTTCCTCCGGCTCACTGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link