abhd6a

Ensembl ID:
ENSDARG00000060756
ZFIN ID:
ZDB-GENE-090925-1
Human Orthologue:
ABHD6
Human Description:
abhydrolase domain containing 6 [Source:HGNC Symbol;Acc:21398]
Mouse Orthologue:
Abhd6
Mouse Description:
abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8711 Nonsense Mutation detected in F1 DNA During 2014
sa6220 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085957 Nonsense 58 339 2 8
Genomic Location:
Chromosome 11 (position 43195881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGCAGACGGCTGGGGATGCAGGTGGATTATGCTGAATATGAAGGTTA[T/A]CGATTCTGTTACTCTCACAGAGGAAATCCAGGCTTTCGTCCATCTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085957 Nonsense 124 339 3 8
Genomic Location:
Chromosome 11 (position 43194105)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATGAAGGTACATCACGCACCAGCGCTGWGGATTATTCCATAGAGGGC[C/T]AAGTCAAACGCATTAATCAGGTGRGRTTTGCTGAAATTGCCTGGAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xro6im45