ENSDARG00000060754

Ensembl ID:
ENSDARG00000060754
Human Orthologue:
ST14
Human Description:
suppression of tumorigenicity 14 (colon carcinoma) [Source:HGNC Symbol;Acc:11344]
Mouse Orthologue:
St14
Mouse Description:
suppression of tumorigenicity 14 (colon carcinoma) Gene [Source:MGI Symbol;Acc:MGI:1338881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24739 Nonsense Available for shipment Available now
sa32549 Nonsense Available for shipment Available now
sa44369 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085942 Nonsense 235 841 7 20
Genomic Location (Zv9):
Chromosome Zv9_scaffold3455 (position 307978)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37155254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGAGTTCTCGTCTCCAGGAAACCCTAAGTCATACCCAGCTTACTCC[C/T]GATGCCAGTGGCAGATCCGCGCCAATAAAGGCTCCGCCATCATTGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085942 Nonsense 444 841 12 20
Genomic Location (Zv9):
Chromosome Zv9_scaffold3455 (position 315431)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37147801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTTACTGTTTTCCTGTTTTCACCCTCACTGATGTTATCTCCAGCTTG[C/A]CCTGGTCAGTTTGCTTGCAGTTCAGGCTATTGTATCAGAAAAGAGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085942 Nonsense 517 841 14 20
Genomic Location (Zv9):
Chromosome Zv9_scaffold3455 (position 318989)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37144243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGAAGGATACTTACCCTTGTTTTGCTTAATTTTCCCATAGACTGTGGC[A/T]GAGCACAGGTGAGGTGTGGCAACGGCGCCTGCATCATGCAGGATTTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link