si:ch1073-179p4.1

Ensembl ID:
ENSDARG00000060751
ZFIN ID:
ZDB-GENE-100921-50
Human Orthologue:
TAOK3
Human Description:
TAO kinase 3 [Source:HGNC Symbol;Acc:18133]
Mouse Orthologue:
Taok3
Mouse Description:
TAO kinase 3 Gene [Source:MGI Symbol;Acc:MGI:3041177]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20366 Nonsense Available for shipment Available now
sa2237 Essential Splice Site Available for shipment Available now
sa20365 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Nonsense 428 903 12 19
ENSDART00000140668 Nonsense 421 896 13 20
Genomic Location (Zv9):
Chromosome 5 (position 17158562)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14887216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTCCTCATCGGGACCACCGGTCGGACCTTCGACCGTCCTCGTCTGAG[C/T]GAGCTCAAGCTCACAACTATAAAAACCGTGAGCGCTTCGCCACCATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Essential Splice Site 718 903 16 19
ENSDART00000140668 Essential Splice Site 711 896 17 20
Genomic Location (Zv9):
Chromosome 5 (position 17140815)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14869469
KASP Assay ID:
554-3028.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACAGGAAACATGTGCTCGAACTTCGGCAGCAGCCCAAGAACCTCAAG[G/A]TACTACCAGTTGTRGAGAAGCRTTTATTACTTTGCTTTATATAGTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085943 Essential Splice Site 850 903 18 19
ENSDART00000140668 Essential Splice Site 843 896 19 20
Genomic Location (Zv9):
Chromosome 5 (position 17135201)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 14863855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCTGGAGCAGAAAGTCTCTCTGCGCAGAGCACACCTGGAACAGAAG[G/A]TCTAGTCCTGCTATTCACCTCTTCTTCACATAGAATCCACTCAAATATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link