BTBD2 (1 of 2)

Ensembl ID:
ENSDARG00000060750
Description:
BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:15504]
Human Orthologue:
BTBD2
Human Description:
BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:15504]
Mouse Orthologue:
Btbd2
Mouse Description:
BTB (POZ) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1933831]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6022 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18657 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085917 Essential Splice Site 232 584 3 9
Genomic Location (Zv9):
Chromosome 2 (position 57026885)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57011778
KASP Assay ID:
554-3673.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACGCATGYGTTACACTTTCCAGAAATATGCAGATCTTGTTTCTCCTC[A/T]GATTCCTGTACTCTGATGAAGTTCATATCGGACCCGAGACRGTGATGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085917 Essential Splice Site 483 584 8 9
Genomic Location (Zv9):
Chromosome 2 (position 57014331)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56999224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTCCTCCAGMAACTGTAMAGACTGTGACGCTGTGTGTTTTATTTTC[A/T]GATCATTCACACYGACAGTAACACAGTWCTGGGTCAGAACGACACKGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link