BTBD2 (1 of 2)

Ensembl ID:
ENSDARG00000060750
Description:
BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:15504]
Human Orthologue:
BTBD2
Human Description:
BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:15504]
Mouse Orthologue:
Btbd2
Mouse Description:
BTB (POZ) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1933831]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6022 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8100 Nonsense Mutation detected in F1 DNA During 2014
sa18657 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085917 Essential Splice Site 232 584 3 9
Genomic Location:
Chromosome 2 (position 57026885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACGCATGYGTTACACTTTCCAGAAATATGCAGATCTTGTTTCTCCTC[A/T]GATTCCTGTACTCTGATGAAGTTCATATCGGACCCGAGACRGTGATGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085917 Nonsense 445 584 6 9
Genomic Location:
Chromosome 2 (position 57014758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGTGCAGCATCACACGCTTCGGGCAGGTGGAAAGTCGCTGGGGCTA[C/G]AGYGGGACYAGTGACCGGATCCGGTGAGAATACACCACCGTTAATACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085917 Essential Splice Site 483 584 8 9
Genomic Location:
Chromosome 2 (position 57014331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTCCTCCAGMAACTGTAMAGACTGTGACGCTGTGTGTTTTATTTTC[A/T]GATCATTCACACYGACAGTAACACAGTWCTGGGTCAGAACGACACKGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qrgggeda