pgm5

Ensembl ID:
ENSDARG00000060745
ZFIN ID:
ZDB-GENE-060503-838
Description:
phosphoglucomutase-like protein 5 [Source:RefSeq peptide;Acc:NP_001119868]
Human Orthologue:
PGM5
Human Description:
phosphoglucomutase 5 [Source:HGNC Symbol;Acc:8908]
Mouse Orthologue:
Pgm5
Mouse Description:
phosphoglucomutase 5 Gene [Source:MGI Symbol;Acc:MGI:1925668]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13857 Essential Splice Site Available for shipment Available now
sa21326 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085894 Essential Splice Site 493 567 10 11
Genomic Location (Zv9):
Chromosome 8 (position 31339866)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30482592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAATTAGCAYTAAATGGTCTACATTCRTACTTTTTGTTCTTGTCCYGC[A/G]GGGCCTAAGGATCATCTTTACCGATTCATCSCGAATCATCTTTCGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085894 Splice Site, Nonsense 538 567 10 11
Genomic Location (Zv9):
Chromosome 8 (position 31340003)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30482729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGCTGAAAGCTACGAGAGAGACCCTGAAAGACACAACAGAGAGACT[C/T]AGGTGAATACAGGATCTTCACTTTGGCTCACAGTCTGTCACTGTATCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: A genome-wide association study of seasonal pattern mania identifies NF1A as a possible susceptibility gene for bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link