appl1

Ensembl ID:
ENSDARG00000060734
ZFIN ID:
ZDB-GENE-081016-1
Description:
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 [Source:Ref
Human Orthologue:
APPL1
Human Description:
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 [Source:HGNC
Mouse Orthologue:
Appl1
Mouse Description:
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 Gene [Source

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3559 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3559
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085868 Nonsense 88 706 4 23
Genomic Location:
Chromosome 11 (position 43684803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTTTTCCTTTAGGTGGCGACGACGAGGTGATGAGCTCCACTTTGCAG[C/T]AGTTTGCTAAAGTTATCGACGAGGTGAGAAACTCCTCCATCGCTCATGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gszexbwh