prkx

Ensembl ID:
ENSDARG00000060716
ZFIN ID:
ZDB-GENE-090313-408
Description:
Novel protein similar to H.sapiens PRKX, protein kinase, X-linked (PRKX) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
PRKX
Human Description:
protein kinase, X-linked [Source:HGNC Symbol;Acc:9441]
Mouse Orthologue:
Prkx
Mouse Description:
protein kinase, X-linked Gene [Source:MGI Symbol;Acc:MGI:1309999]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25613 Nonsense Mutation detected in F1 DNA During 2017
sa31211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085851 Nonsense 210 357 4 8
ENSDART00000136761 Nonsense 214 361 4 8
Genomic Location (Zv9):
Chromosome 1 (position 32922947)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32525127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTCTTATTTTCAAGGACATGGACTCTGTGCGGCACTCCTGAGTATT[T/A]GGCTCCAGAGGTGATTCAGAGTAAAGGTCATGGGCGAGCTGTGGACTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085851 Nonsense 335 357 8 8
ENSDART00000136761 Nonsense 339 361 8 8
Genomic Location (Zv9):
Chromosome 1 (position 32945630)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32547810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTTCCAAAGGTGTCCCACGAGGGAGACACATCCAACTTTGACTCCTA[T/A]CCAGATGAGGAGTGGAAGAAGGACACACCGGTACCAGCGAAAGATCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link