nsd1b

Ensembl ID:
ENSDARG00000060705
ZFIN ID:
ZDB-GENE-080519-2
Description:
Nuclear receptor binding SET domain protein 1b [Source:UniProtKB/TrEMBL;Acc:A5XBP9]
Human Orthologues:
EZH1, EZH2, SETD2, WHSC1, WHSC1L1
Human Descriptions:
enhancer of zeste homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3526]
enhancer of zeste homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3527]
SET domain containing 2 [Source:HGNC Symbol;Acc:18420]
Wolf-Hirschhorn syndrome candidate 1 [Source:HGNC Symbol;Acc:12766]
Wolf-Hirschhorn syndrome candidate 1-like 1 [Source:HGNC Symbol;Acc:12767]
Mouse Orthologues:
Ezh1, Ezh2, Setd2, Whsc1, Whsc1l1
Mouse Descriptions:
enhancer of zeste homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1097695]
enhancer of zeste homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:107940]
SET domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918177]
Wolf-Hirschhorn syndrome candidate 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1276574]
Wolf-Hirschhorn syndrome candidate 1-like 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2142581]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43693 Nonsense Mutation detected in F1 DNA During 2017
sa43694 Nonsense Mutation detected in F1 DNA During 2017
sa30724 Nonsense Mutation detected in F1 DNA During 2017
sa24006 Nonsense Available for shipment Available now
sa37358 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131188 Nonsense 424 1873 4 22
ENSDART00000137883   None 117 None 3
ENSDART00000143621 Nonsense 317 1717 4 20

The following transcripts of ENSDARG00000060705 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 36684145)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37673494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAATTAAATCTGTGAATTGTTCTTTTGGAAAGGTATCTTGTAAAATT[A/T]AGATGCCAGATTCTGCAAGCATGAAACCCAAGGACAATCACAACACCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131188 Nonsense 542 1873 4 22
ENSDART00000137883   None 117 None 3
ENSDART00000143621 Nonsense 435 1717 4 20

The following transcripts of ENSDARG00000060705 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 36684499)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37673848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCAAAATTAGCACACACGCAAAGCTGTCTTCAGAACTTTTATGTTGT[A/T]AAGATGATGAGCATTCAGTCAAATCTGAAGATGAATCTTCTTTAGTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131188 Nonsense 958 1873 7 22
ENSDART00000137883   None 117 None 3
ENSDART00000143621   None 1717 None 20

The following transcripts of ENSDARG00000060705 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 36689513)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37678862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTAATAATTTTTTAATAGGTGACAGTGTGTGTCTAAACTCAAAGAGA[C/T]AGCGCAAACCCACAAAAAAGATTTTAGAAAGCTCCATTGAAGCAGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131188 Nonsense 1168 1873 12 22
ENSDART00000137883   None 117 None 3
ENSDART00000143621 Nonsense 1012 1717 10 20

The following transcripts of ENSDARG00000060705 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 36700687)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37690036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTGAAGACGTCAGGCGCTGTATGGTTCCCGGATGTGGAAAGTTCTA[T/A]CATGGGGAGTGTGCTGCCAGCCATGCACCTACAGTACCTCTGAACCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131188 Nonsense 1709 1873 22 22
ENSDART00000137883   None 117 None 3
ENSDART00000143621 Nonsense 1553 1717 20 20

The following transcripts of ENSDARG00000060705 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 36723103)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37712452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCAATGAATAACGTGTCTTGTATTTCAGGACGTTGGGAGTGTCCTTG[G/A]CATCAGTGTGACTTGTGTGGACAGGAAGCTGCTTCCTTCTGTGAGATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link