npffr2.2

Ensembl ID:
ENSDARG00000060702
ZFIN ID:
ZDB-GENE-070705-159
Description:
Novel protein similar to human and mouse neuropeptide FF receptor 2 (NPFFR2) [Source:UniProtKB/TrEMB
Human Orthologue:
NPFFR2
Human Description:
neuropeptide FF receptor 2 [Source:HGNC Symbol;Acc:4525]
Mouse Orthologue:
Npffr2
Mouse Description:
neuropeptide FF receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1860130]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa478 Nonsense Confirmed mutation in F2 line During 2017
sa26511 Essential Splice Site Mutation detected in F1 DNA During 2017
sa5304 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa478
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Nonsense 118 438 2 6
ENSDART00000135063 Nonsense 89 336 2 3
Genomic Location (Zv9):
Chromosome 5 (position 34717352)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32499301
KASP Assay ID:
554-0210.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTTTTCATGTTTCTCCTGCAGGCTGGCCTTTTGGCAGTTTGGTGTGT[A/T]AGCTGAGTGGGATGGTGCAAGGAATATCAGTATCCGCATCAGTATTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Essential Splice Site 423 438 3 6
ENSDART00000135063   None 336 None 3
Genomic Location (Zv9):
Chromosome 5 (position 34722117)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32504066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGACTCATCCAGGGGCTGGTGTCTGTGAGCAATGGGAAGGGTTTGGG[T/G]GAAAGAAGCCAGTCTTCAGGGAAAGAGAACATGAAAGAACAGGATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5304
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085821 Essential Splice Site 428 438 5 6
ENSDART00000135063   None 336 None 3
Genomic Location (Zv9):
Chromosome 5 (position 34723130)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32505079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAACAAGTTTRGTRATYCCTGCTTTACAGCATGCACATAAAATAATTT[G/A]AATGCCAAACAASATATATACAGCTGAAGTCAGAATGATTAGCCCCCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link