mll4b

Ensembl ID:
ENSDARG00000060697
ZFIN ID:
ZDB-GENE-080521-1
Description:
Myeloid/lymphoid or mixed-lineage leukemia 4b [Source:UniProtKB/TrEMBL;Acc:A5XBQ6]
Human Orthologue:
AD000671.3
Human Description:
Histone-lysine N-methyltransferase MLL4 [Source:UniProtKB/Swiss-Prot;Acc:Q9UMN6]
Mouse Orthologue:
Wbp7
Mouse Description:
WW domain binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:109565]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4623 Nonsense Mutation detected in F1 DNA During 2014
sa22705 Nonsense Mutation detected in F1 DNA During 2014
sa22704 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 1393 3111 19 35
Genomic Location:
Chromosome 15 (position 36183119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATCTGGCTAATATGCAGAAGGGTCATTTGATGGACATGAGGGCGTTA[C/T]GAATGARCCTGAAAGGTAAATAAACATACATGCCAAAGCAGTAGGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 1723 3111 27 35
Genomic Location:
Chromosome 15 (position 36179912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAGCTGCTCCATCCAAACCCCACCACATCTTGACTATTAGTGATT[T/A]GGAAGACACTCGAAGGCCTCGACGGCATAGCCCTCACACCCAAAATAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127708 None None 124 None 5
ENSDART00000128947 Nonsense 2091 3111 27 35
Genomic Location:
Chromosome 15 (position 36178809)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTAATTGTTGTTTTGAGTCAGTTCCCAACTCAGAGGTGCTCACTGAC[C/T]AAGATTCCTTTGGGCTTACTCAAATTTTGGAATCCAGCTCTGGGGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2qzjdxob