ENSDARG00000060688

Ensembl ID:
ENSDARG00000060688
Human Orthologues:
TRIM50, TRIM62, TRIM72, TRIM73, TRIM74
Human Descriptions:
tripartite motif-containing 50 [Source:HGNC Symbol;Acc:19017]
tripartite motif-containing 62 [Source:HGNC Symbol;Acc:25574]
tripartite motif-containing 72 [Source:HGNC Symbol;Acc:32671]
tripartite motif-containing 73 [Source:HGNC Symbol;Acc:18162]
tripartite motif-containing 74 [Source:HGNC Symbol;Acc:17453]
Mouse Orthologues:
Trim50, Trim62, Trim72
Mouse Descriptions:
tripartite motif-containing 50 Gene [Source:MGI Symbol;Acc:MGI:2664992]
tripartite motif-containing 62 Gene [Source:MGI Symbol;Acc:MGI:1914775]
tripartite motif-containing 72 Gene [Source:MGI Symbol;Acc:MGI:3612190]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41728 Nonsense Mutation detected in F1 DNA During 2017
sa44730 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085792 Nonsense 366 548 5 6
Genomic Location (Zv9):
Chromosome 10 (position 42214479)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40927188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGGCCCCTGCAGTACAGAGTCTGGAAGTCACTCAAGGGCAGCATCTA[T/A]CCAGGTCAGAGAAAAGAAAAAGATAAATAACTTTAAGGGAAGAAAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085792 Essential Splice Site 367 548 5 6
Genomic Location (Zv9):
Chromosome 10 (position 42214484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCTGCAGTACAGAGTCTGGAAGTCACTCAAGGGCAGCATCTATCCAG[G/A]TCAGAGAAAAGAAAAAGATAAATAACTTTAAGGGAAGAAAAACATACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link