chd2

Ensembl ID:
ENSDARG00000060687
ZFIN ID:
ZDB-GENE-050419-256
Description:
Novel protein similar to human chromodomain helicase DNA binding protein 2 (CHD2) [Source:UniProtKB/
Human Orthologue:
CHD2
Human Description:
chromodomain helicase DNA binding protein 2 [Source:HGNC Symbol;Acc:1917]
Mouse Orthologue:
Chd2
Mouse Description:
chromodomain helicase DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2448567]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23307 Nonsense Available for shipment Available now
sa43114 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2949 Essential Splice Site F2 line generated During 2016
sa36653 Essential Splice Site Available for shipment Available now
sa15642 Essential Splice Site Available for shipment Available now
sa43113 Nonsense Mutation detected in F1 DNA During 2016
sa8424 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Nonsense 132 1694 3 35
ENSDART00000127730 Nonsense 128 1813 3 37
ENSDART00000136434 Nonsense 127 148 3 4
Genomic Location (Zv9):
Chromosome 18 (position 24765191)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24994964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATCCAGTCGCAGTAGACAAGAGCCTGCACGCCTTAATATTGGAGCT[G/T]AGGTAAATAATAATTCAACCCTGACCTCTAGTGGTTGCTTTCAGTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 133 1694 None 35
ENSDART00000127730 Essential Splice Site 129 1813 None 37
ENSDART00000136434 Essential Splice Site 128 148 None 4
Genomic Location (Zv9):
Chromosome 18 (position 24764871)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24994644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGCTTGTTCCTTGTATTCTAAATGGATTTTCATGGGTTTTAATTTTT[A/T]GGGCAGCAGTGATTCAGAGGGAGAAAGTTCCAAACGAAAAAGCTCTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2949
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 397 1694 9 35
ENSDART00000127730 Essential Splice Site 393 1813 9 37
ENSDART00000136434   None 148 None 4
Genomic Location (Zv9):
Chromosome 18 (position 24756892)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24986665
KASP Assay ID:
554-2485.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCACAAACGACCTGAGCAAGCAGTTCCAGATAATAGAGAGGGTGATTG[G/A]TAAGTCTTATCTTAACTCTTATTCTTAAAAAAANCTACACTTCTGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 496 1694 11 35
ENSDART00000127730 Essential Splice Site 506 1813 12 37
ENSDART00000136434   None 148 None 4
Genomic Location (Zv9):
Chromosome 18 (position 24754317)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24984090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTACCAGCTAGATGGAGTGAACTGGCTGGCACACTCCTGGTGCAGG[T/C]ATGTAACGCACCAGAGGTGTTATGAGTGTGAGTGTGTCTAAATGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 662 1694 14 35
ENSDART00000127730 Essential Splice Site 672 1813 15 37
ENSDART00000136434   None 148 None 4
Genomic Location (Zv9):
Chromosome 18 (position 24752301)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24982074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCCCTCAAAGAGCTRTGGTCCCTTCTGCAMTTTCTGATGTCTGACAA[G/T]TAGGTACTCAYWGTTAGGGTYACRTCTTTAGATGCAAATATAGATTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Nonsense 826 1694 17 35
ENSDART00000127730 Nonsense 836 1813 18 37
ENSDART00000136434   None 148 None 4
Genomic Location (Zv9):
Chromosome 18 (position 24747841)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24977614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGATGGTCCGCATGTTGGACATTCTTGCTGATTACTTGTCTATGAAA[C/T]GATATCAATTCCAGGTATGATCTCAGCAGTACTGCAAAGTGTTGAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 1288 1694 27 35
ENSDART00000127730 Essential Splice Site 1298 1813 28 37
ENSDART00000136434   None 148 None 4
Genomic Location (Zv9):
Chromosome 18 (position 24731261)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 24961034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACTGGGACTTGAWCAAGACTGATCCTGACCTCAAACTTTCAGAGAAR[G/A]TACRTCTAATTAAATGAYTGCTTGCTCCAAAATTCATGTCGCTTGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link