chd2

Ensembl ID:
ENSDARG00000060687
ZFIN ID:
ZDB-GENE-050419-256
Description:
Novel protein similar to human chromodomain helicase DNA binding protein 2 (CHD2) [Source:UniProtKB/
Human Orthologue:
CHD2
Human Description:
chromodomain helicase DNA binding protein 2 [Source:HGNC Symbol;Acc:1917]
Mouse Orthologue:
Chd2
Mouse Description:
chromodomain helicase DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2448567]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23307 Nonsense Mutation detected in F1 DNA During 2014
sa2949 Essential Splice Site F2 line generated During 2014
sa15642 Essential Splice Site Available for shipment Available now
sa8424 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Nonsense 132 1694 3 35
ENSDART00000127730 Nonsense 128 1813 3 37
ENSDART00000136434 Nonsense 127 148 3 4
Genomic Location:
Chromosome 18 (position 24765191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATCCAGTCGCAGTAGACAAGAGCCTGCACGCCTTAATATTGGAGCT[G/T]AGGTAAATAATAATTCAACCCTGACCTCTAGTGGTTGCTTTCAGTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2949
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 397 1694 9 35
ENSDART00000127730 Essential Splice Site 393 1813 9 37
ENSDART00000136434 None None 148 None 4
Genomic Location:
Chromosome 18 (position 24756892)
KASP Assay ID:
554-2485.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCACAAACGACCTGAGCAAGCAGTTCCAGATAATAGAGAGGGTGATTG[G/A]TAAGTCTTATCTTAACTCTTATTCTTAAAAAAANCTACACTTCTGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 662 1694 14 35
ENSDART00000127730 Essential Splice Site 672 1813 15 37
ENSDART00000136434 None None 148 None 4
Genomic Location:
Chromosome 18 (position 24752301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCCCTCAAAGAGCTRTGGTCCCTTCTGCAMTTTCTGATGTCTGACAA[G/T]TAGGTACTCAYWGTTAGGGTYACRTCTTTAGATGCAAATATAGATTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085735 Essential Splice Site 1288 1694 27 35
ENSDART00000127730 Essential Splice Site 1298 1813 28 37
ENSDART00000136434 None None 148 None 4
Genomic Location:
Chromosome 18 (position 24731261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACTGGGACTTGAWCAAGACTGATCCTGACCTCAAACTTTCAGAGAAR[G/A]TACRTCTAATTAAATGAYTGCTTGCTCCAAAATTCATGTCGCTTGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ngd7tqbw