lrsam1

Ensembl ID:
ENSDARG00000060683
ZFIN ID:
ZDB-GENE-060526-97
Description:
E3 ubiquitin-protein ligase LRSAM1 [Source:RefSeq peptide;Acc:NP_001093474]
Human Orthologue:
LRSAM1
Human Description:
leucine rich repeat and sterile alpha motif containing 1 [Source:HGNC Symbol;Acc:25135]
Mouse Orthologue:
Lrsam1
Mouse Description:
leucine rich repeat and sterile alpha motif containing 1 Gene [Source:MGI Symbol;Acc:MGI:2684789]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33645 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085769 Essential Splice Site 252 721 10 24
Genomic Location (Zv9):
Chromosome 5 (position 34497283)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32279232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCTCTCTTACTGTAGAACAAATTTATGGACTATGAGAAAAGAAAGG[T/C]ATGTTTGATTAAGTTTTGTGTTGGATTGTCTAGTGAAGCGGTATTTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link