LOC799158

Ensembl ID:
ENSDARG00000060680
Human Orthologue:
PRSS12
Human Description:
protease, serine, 12 (neurotrypsin, motopsin) [Source:HGNC Symbol;Acc:9477]
Mouse Orthologue:
Prss12
Mouse Description:
protease, serine, 12 neurotrypsin (motopsin) Gene [Source:MGI Symbol;Acc:MGI:1100881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17777 Nonsense Available for shipment Available now
sa42077 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35348 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085774 Nonsense 158 835 4 14
Genomic Location (Zv9):
Chromosome 12 (position 36173529)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35048896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTTGTGACACACACTGGAMAGATCGTGATGCCAGCGTTGTTTGCCGA[C/T]AGCTTGGATTAGGGTATGAAACTTATGGGYACTTTACTTTAAAGGGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085774 Essential Splice Site 271 835 6 14
Genomic Location (Zv9):
Chromosome 12 (position 36156142)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35066283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGGATGACATGGACGCTGAGGTGGTCTGCAGGCAACTCGGACTGGGG[T/C]GAGTCCAGTCTACTGCTCATACATCAAATGCTGACCCCACACACCCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085774 Nonsense 743 835 14 14
Genomic Location (Zv9):
Chromosome 12 (position 36128967)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35093458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATCCCAGCACACTTCTTCAGGCCTGGGTTCCTCTCCTGCCCTCGTG[G/A]CAGTGTAAGAAACGTTACGGCGAGCGTTTCACCAGCCACGACATGTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link