LOC799158

Ensembl ID:
ENSDARG00000060680
Human Orthologue:
PRSS12
Human Description:
protease, serine, 12 (neurotrypsin, motopsin) [Source:HGNC Symbol;Acc:9477]
Mouse Orthologue:
Prss12
Mouse Description:
protease, serine, 12 neurotrypsin (motopsin) Gene [Source:MGI Symbol;Acc:MGI:1100881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17777 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085774 Nonsense 158 835 4 14
Genomic Location:
Chromosome 12 (position 36173529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTTGTGACACACACTGGAMAGATCGTGATGCCAGCGTTGTTTGCCGA[C/T]AGCTTGGATTAGGGTATGAAACTTATGGGYACTTTACTTTAAAGGGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wegjwsq3