kdm1a

Ensembl ID:
ENSDARG00000060679
ZFIN ID:
ZDB-GENE-030131-7828
Description:
Aof2 protein [Source:UniProtKB/TrEMBL;Acc:A0JMQ3]
Human Orthologue:
KDM1A
Human Description:
lysine (K)-specific demethylase 1A [Source:HGNC Symbol;Acc:29079]
Mouse Orthologue:
Kdm1a
Mouse Description:
lysine (K)-specific demethylase 1A Gene [Source:MGI Symbol;Acc:MGI:1196256]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23095 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085758 Essential Splice Site 737 848 19 21
Genomic Location:
Chromosome 17 (position 28146512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTGGCCATCCTCAAGGGCATTTTTGGAAGCAGCGCAGTCCCTCAG[G/A]TGAGCTCGGAGGCGCTTGCTTCATTTTTAGCTCTGTGCTTTTACAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wibjp2iw