kdm1a

Ensembl ID:
ENSDARG00000060679
ZFIN ID:
ZDB-GENE-030131-7828
Description:
Aof2 protein [Source:UniProtKB/TrEMBL;Acc:A0JMQ3]
Human Orthologue:
KDM1A
Human Description:
lysine (K)-specific demethylase 1A [Source:HGNC Symbol;Acc:29079]
Mouse Orthologue:
Kdm1a
Mouse Description:
lysine (K)-specific demethylase 1A Gene [Source:MGI Symbol;Acc:MGI:1196256]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42949 Nonsense Mutation detected in F1 DNA During 2016
sa36433 Nonsense Mutation detected in F1 DNA During 2016
sa23095 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085758 Nonsense 412 848 11 21
Genomic Location:
Chromosome 17 (position 28154664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTAACAACAAACCTGTGTCTCTGGGACAAGCACTGGAAGTGGTCATA[C/T]AGTGAGTAAACTCTGTTTGCCTCATGTTCTGTCACTGAACATTTGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085758 Nonsense 627 848 17 21
Genomic Location:
Chromosome 17 (position 28149976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATAAATGTGACGCCGTGTTGTGTACCCTACCTTTGGGAGTGATGAAA[C/T]AGCAGCCGCCGGCCGTGCAGTTTGTCCCTCCTCTGCCAGAATGGAAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085758 Essential Splice Site 737 848 19 21
Genomic Location:
Chromosome 17 (position 28146512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTGGCCATCCTCAAGGGCATTTTTGGAAGCAGCGCAGTCCCTCAG[G/A]TGAGCTCGGAGGCGCTTGCTTCATTTTTAGCTCTGTGCTTTTACAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link