ndst2

Ensembl ID:
ENSDARG00000060678
Human Orthologue:
NDST2
Human Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 [Source:HGNC Symbol;Acc:7681]
Mouse Orthologue:
Ndst2
Mouse Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 Gene [Source:MGI Symbol;Acc:MGI:97040]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13344 Nonsense Available for shipment Available now
sa31891 Nonsense Available for shipment Available now
sa35347 Nonsense Mutation detected in F1 DNA During 2017
sa9179 Nonsense Mutation detected in F1 DNA During 2017
sa27994 Nonsense Mutation detected in F1 DNA During 2017
sa9867 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085743 Nonsense 124 894 1 13
Genomic Location (Zv9):
Chromosome 12 (position 36005693)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35216202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAGARATTGTTGCCATTTTAGAGTCAAGCCGATTTCATTATCGCACT[G/T]AAATTGCACCGGGTAAAGGAGACATGCCRCCTCTGGCTTGGCGAGGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085743 Nonsense 142 894 1 13
Genomic Location (Zv9):
Chromosome 12 (position 36005639)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35216256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCACCGGGTAAAGGAGACATGCCACCTCTGGCTTGGCGAGGCCGTGGC[C/T]GATACTCACTCATCATCTATGAGAACCTGCTCAAGTATGTCAACTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085743 Nonsense 394 894 3 13
Genomic Location (Zv9):
Chromosome 12 (position 36001156)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35220739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGAAGACGAGGGTGACGACACGCTGCTACGTCACCGGCAGGAGTTTT[G/A]GTGGTTTCCGCACATGTGGAGTCACATGCAGCCTCATCTCTTCCACAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085743 Nonsense 587 894 6 13
Genomic Location (Zv9):
Chromosome 12 (position 35996993)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35224902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCCTGTCAGACTCGCTCAYAAATACTTCCAGATTTTCCCTGATGAG[A/T]GAGACCCCTTGTGGCAGGTTTGTGCAAGTACATTTTTGTGATTTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085743 Nonsense 726 894 10 13
Genomic Location (Zv9):
Chromosome 12 (position 35990764)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35231131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGAGCTGAAAATAGTTTAATCCGTCTGCCGTCTCTCTGTCTCCAGCAT[C/T]AGAGGGCTCATCAGGACCCTGTGGCGCTGAACCACACATTTGATGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085743 Nonsense 847 894 12 13
Genomic Location (Zv9):
Chromosome 12 (position 35985226)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35236669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGAGGCAGGACGCTCTCGCTGTCTGGGAAAAAGCAAAGGAAGGAAATA[T/A]CCCGACATGAGCCTTGAGGTACAWCTCACTTCTCAGCATCAGATCTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link