NID1 (2 of 2)

Ensembl ID:
ENSDARG00000060675
Description:
nidogen 1 [Source:HGNC Symbol;Acc:7821]
Human Orthologue:
NID1
Human Description:
nidogen 1 [Source:HGNC Symbol;Acc:7821]
Mouse Orthologue:
Nid1
Mouse Description:
nidogen 1 Gene [Source:MGI Symbol;Acc:MGI:97342]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13713 Essential Splice Site Available for shipment Available now
sa38863 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085724 Essential Splice Site 1069 1242 16 21
Genomic Location (Zv9):
Chromosome 11 (position 45443935)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44335927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATGACCTCATAAACCCGCGGCCAATCATCGCAGAGCCTGTAWATGGG[T/G]ACGAATGCATGACACRGCTAAAACAYGCTWAAGTAGAGCAGCGCGARYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085724 Nonsense 1078 1242 17 21
Genomic Location (Zv9):
Chromosome 11 (position 45444298)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44336290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTAGTTTTCCCTGTCCTGCAGTCGTCTGTACTGGGCTGATTGGAAC[C/T]GAGATGGGCCGAAGATCGAGAGCTCCAGCATGGATGGGACAGAGCGCACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cutaneous nevi: Genome-wide association study identifies nidogen 1 (NID1) as a susceptibility locus to cutaneous nevi and melanoma risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link