LOC569443

Ensembl ID:
ENSDARG00000060662
Human Orthologue:
PRF1
Human Description:
perforin 1 (pore forming protein) [Source:HGNC Symbol;Acc:9360]
Mouse Orthologue:
Prf1
Mouse Description:
perforin 1 (pore forming protein) Gene [Source:MGI Symbol;Acc:MGI:97551]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20037 Nonsense Available for shipment Available now
sa16552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085736 Nonsense 94 601 1 4
Genomic Location:
Chromosome 3 (position 31120281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGGATCTCAATAACAACACGTGTAATCTGTGCAAAAACCCATTCATG[C/T]AGAACGAAAAGCAGAAGCTCCCGGTGTCAGCCGTCTACTGGAGGGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085736 Nonsense 344 601 4 4
Genomic Location:
Chromosome 3 (position 31124385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCAATGACCCTGGTGCTTRTAAACAGTGGCTCTCCTCAGTGCCTCAA[C/T]AGCCAGAMGTGATMTCCTTCTCACYGAAACCCCTCCACATGCTAATGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/190qg230