lrp2

Ensembl ID:
ENSDARG00000060649
ZFIN ID:
ZDB-GENE-050119-2
Description:
low-density lipoprotein receptor-related protein 2 [Source:RefSeq peptide;Acc:NP_001181916]
Human Orthologue:
LRP2
Human Description:
low density lipoprotein receptor-related protein 2 [Source:HGNC Symbol;Acc:6694]
Mouse Orthologue:
Lrp2
Mouse Description:
low density lipoprotein receptor-related protein 2 Gene [Source:MGI Symbol;Acc:MGI:95794]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25440 Nonsense Mutation detected in F1 DNA During 2014
sa5574 Nonsense Mutation detected in F1 DNA During 2014
sa17023 Essential Splice Site Available for shipment Available now
sa25 Essential Splice Site Confirmed mutation in F2 line During 2014
sa18967 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21599 Nonsense Available for shipment Available now
sa21600 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Nonsense 191 4632 5 77
ENSDART00000129237 None None 3092 None 50
Genomic Location:
Chromosome 9 (position 49457146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCTACATCTGCGATCATGATGACGATTGCGGAGACAGAAGTGATGAA[C/T]AAAACTGCAGTACGTACATTTCATTTATTCATTCATTTTCTTTTGCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Nonsense 441 4632 11 77
ENSDART00000129237 None None 3092 None 50
Genomic Location:
Chromosome 9 (position 49478789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGGACGGCTCGCGTCTGCAGGTGGTGCTGAACGTGTCGGTGGACTA[T/A]CCCGAAAATCTGGCCGTGGACTGGGTGAACAATAAGCTGTATGTAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Essential Splice Site 3366 4632 50 77
ENSDART00000129237 Essential Splice Site 1826 3092 23 50
Genomic Location:
Chromosome 9 (position 49660743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCAACGACAAACTCTACTGGTCTGAYGCTCATCTCAACTACATTGAG[T/C]AAGACTCGCTCAGGYTTATATTCTGGGTGATTTAGTTAAATTCAATTYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Essential Splice Site 3565 4632 53 77
ENSDART00000129237 Essential Splice Site 2025 3092 26 50
Genomic Location:
Chromosome 9 (position 49669867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAATCAGGACTGTCCCGACGGCTCCGATGAGGACACTGTGCTCTGTG[G/A]TACGGAACAATATAATGATATATAATTTTCCACAAATTGATGTGATTTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Essential Splice Site 3648 4632 55 77
ENSDART00000129237 Essential Splice Site 2108 3092 28 50
Genomic Location:
Chromosome 9 (position 49675097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCAGGGTGACTTTAAGTGTAATGCAGTATTTTTCTCTGTTGTTTGC[A/T]GTGGGTCCGGCGTACAGATGTGACAATCACACAGAGTTTGACTGCAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Nonsense 3825 4632 59 77
ENSDART00000129237 Nonsense 2285 3092 32 50
Genomic Location:
Chromosome 9 (position 49688919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACACGCTACCCGAACAGCACCTACTGTCCACCCTTCCTGTTTGAGTG[T/A]AAGAACCATGTGTGTGTGCAGCAGCACTGGATATGTGATGGAGATAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085697 Nonsense 4536 4632 75 77
ENSDART00000129237 Nonsense 2996 3092 48 50
Genomic Location:
Chromosome 9 (position 49712960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACGTCAGTGCGGACCAGGTGGACAATAACTTCTCAAACCCCACATA[T/A]CAGCAGGCAGTGGAGGTGAAGAGCGAACAAGTAGAGGAGAAAAACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/myncay1i