senp5

Ensembl ID:
ENSDARG00000060646
ZFIN ID:
ZDB-GENE-050208-772
Description:
sentrin-specific protease 5 [Source:RefSeq peptide;Acc:NP_001073666]
Human Orthologue:
SENP5
Human Description:
SUMO1/sentrin specific peptidase 5 [Source:HGNC Symbol;Acc:28407]
Mouse Orthologue:
Senp5
Mouse Description:
SUMO/sentrin specific peptidase 5 Gene [Source:MGI Symbol;Acc:MGI:2443596]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13930 Nonsense Available for shipment Available now
sa5974 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085701 Nonsense 55 487 1 10
ENSDART00000148051   None 229 None 8
Genomic Location (Zv9):
Chromosome 22 (position 41964126)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38932119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCCAACGGAAAGCMCCACATGCCTGGACACGAGCAGGTTTCGAAGAAA[C/T]GAGGCCGCAAGAAGAAGGAGATGGTGAGCCAGGGAGAAGTGGCCGCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085701 Essential Splice Site 398 487 6 10
ENSDART00000148051 Essential Splice Site 140 229 5 8
Genomic Location (Zv9):
Chromosome 22 (position 41971088)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38939081
KASP Assay ID:
554-3733.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAACTTCTACGACTCCCAGGGCATCCTGTTCAAGTTCGCTCTGGACG[T/C]GAGTGTTTTMTGAGCCGTGTGTTTGAGCWGAATCRCCACNNNNNNCTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link