si:ch211-258l4.6

Ensembl ID:
ENSDARG00000060645
ZFIN ID:
ZDB-GENE-050208-612
Description:
Novel protein similar to vertebratesirtuin (Silent mating type information regulation 2 homolog) 7 (
Human Orthologue:
SIRT7
Human Description:
sirtuin 7 [Source:HGNC Symbol;Acc:14935]
Mouse Orthologue:
Sirt7
Mouse Description:
sirtuin 7 (silent mating type information regulation 2, homolog) 7 (S. cerevisiae) Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24226 Nonsense Available for shipment Available now
sa30735 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085685 Nonsense 109 405 3 10
ENSDART00000130055 Nonsense 102 376 3 9
Genomic Location (Zv9):
Chromosome 22 (position 41984391)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38952384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCAGCTGGCAGAGGCAGTCCAGCGGGCCAAACATCTGGTCATTTA[C/A]ACCGGAGCAGGAATCAGTACGGTGCGTCTCGCGTTCAGCTCAAAGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085685 Nonsense 356 405 10 10
ENSDART00000130055 Nonsense 327 376 9 9
Genomic Location (Zv9):
Chromosome 22 (position 41990605)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38958598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGCAGGACCCCATCTTCAGCATGGCTAAACCCCTCAGTCCGCAAGAG[C/T]AGAAGAGTCACTCTCGTAAAGAGATAGCGCCACCTTCTGCTTTAGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link