prkaa2

Ensembl ID:
ENSDARG00000060641
ZFIN ID:
ZDB-GENE-081120-5
Human Orthologue:
PRKAA2
Human Description:
protein kinase, AMP-activated, alpha 2 catalytic subunit [Source:HGNC Symbol;Acc:9377]
Mouse Orthologue:
Prkaa2
Mouse Description:
protein kinase, AMP-activated, alpha 2 catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1336173]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5948 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085668 Essential Splice Site 80 555 4 12
Genomic Location (Zv9):
Chromosome 20 (position 8218675)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8053045
KASP Assay ID:
554-3667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGATTCAGAACCTTAAGCTCTTCAGACATCCACACATCATCAAGCTG[T/C]GAGTGAAACGCTCATTAAAACACATCCACATTTACTGAGAATCATTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphocyte counts: The combination of a genome-wide association study of lymphocyte count and analysis of gene expression data reveals novel asthma candidate genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link