apba2

Ensembl ID:
ENSDARG00000060639
ZFIN ID:
ZDB-GENE-030131-5371
Human Orthologue:
APBA2
Human Description:
amyloid beta (A4) precursor protein-binding, family A, member 2 [Source:HGNC Symbol;Acc:579]
Mouse Orthologue:
Apba2
Mouse Description:
amyloid beta (A4) precursor protein-binding, family A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1261

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34095 Nonsense Available for shipment Available now
sa20981 Nonsense Available for shipment Available now
sa40922 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11600 Essential Splice Site Available for shipment Available now
sa13279 Essential Splice Site Available for shipment Available now
sa17752 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Nonsense 55 796 1 13
Genomic Location (Zv9):
Chromosome 7 (position 32203671)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30596013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGAGTATGAAGAGCACCATGACCCCGAGGTGACCCAACACTCTTA[C/A]CACAACCAAGAAGAGGCAGATTTGACAGACAGCCGACCGACTACGCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Nonsense 94 796 1 13
Genomic Location (Zv9):
Chromosome 7 (position 32203787)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30596129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGAGACTACCACAGCCACCCGGACAGTCTGGACGGAGACTCCAGCT[C/A]AGACTATGTCAATAACACATCAGATGAGGAAGAGGATGACTTTGATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 452 796 5 13
Genomic Location (Zv9):
Chromosome 7 (position 32215781)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30608123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAACATCCGGATGATGCAGGCCCAGGAGGCAGTGAGCAGGGTCAAGG[T/G]ACGAAACCCAAGGACCTCAATATTTCCATTTGATTTCAGTGTGGAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 686 796 10 13
Genomic Location (Zv9):
Chromosome 7 (position 32245868)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30638210
KASP Assay ID:
2259-9012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAGCCTGGTGGGGCTTCCTCTCGCCACCTGTCAGGGAATCATCAAGG[T/A]GTGCTACTAGGRTTTGGGCTGTCTGTCTGAACACCGGCCAGRAATCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 726 796 11 13
ENSDART00000085661 Essential Splice Site 726 796 11 13
Genomic Location (Zv9):
Chromosome 7 (position 32248230)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30640572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCCAGACCTCAAGTACCAGCTGGGMTTCAGTGTGCAGAAWGGCATT[G/T]TGAGTATGGAAGAACTCRRAAATGTTGAGATGAGTTGATGAGTTTTATYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 726 796 11 13
ENSDART00000085661 Essential Splice Site 726 796 11 13
Genomic Location (Zv9):
Chromosome 7 (position 32248230)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30640572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCCAGACCTCAAGTACCAGCTGGGMTTCAGTGTGCAGAAWGGCATT[G/A]TGAGTATGGAAGAACTCRRAAATGTTGAGATGAGTTGATGAGTTTTATYG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link