apba2

Ensembl ID:
ENSDARG00000060639
ZFIN ID:
ZDB-GENE-030131-5371
Human Orthologue:
APBA2
Human Description:
amyloid beta (A4) precursor protein-binding, family A, member 2 [Source:HGNC Symbol;Acc:579]
Mouse Orthologue:
Apba2
Mouse Description:
amyloid beta (A4) precursor protein-binding, family A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1261

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20981 Nonsense Mutation detected in F1 DNA During 2014
sa11600 Essential Splice Site Available for shipment Available now
sa13279 Essential Splice Site Available for shipment Available now
sa17752 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Nonsense 94 796 1 13
Genomic Location:
Chromosome 7 (position 32203787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGAGACTACCACAGCCACCCGGACAGTCTGGACGGAGACTCCAGCT[C/A]AGACTATGTCAATAACACATCAGATGAGGAAGAGGATGACTTTGATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 686 796 10 13
Genomic Location:
Chromosome 7 (position 32245868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAGCCTGGTGGGGCTTCCTCTCGCCACCTGTCAGGGAATCATCAAGG[T/A]GTGCTACTAGGRTTTGGGCTGTCTGTCTGAACACCGGCCAGRAATCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 726 796 11 13
ENSDART00000085661 Essential Splice Site 726 796 11 13
Genomic Location:
Chromosome 7 (position 32248230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCCAGACCTCAAGTACCAGCTGGGMTTCAGTGTGCAGAAWGGCATT[G/T]TGAGTATGGAAGAACTCRRAAATGTTGAGATGAGTTGATGAGTTTTATYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085661 Essential Splice Site 726 796 11 13
ENSDART00000085661 Essential Splice Site 726 796 11 13
Genomic Location:
Chromosome 7 (position 32248230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCCAGACCTCAAGTACCAGCTGGGMTTCAGTGTGCAGAAWGGCATT[G/A]TGAGTATGGAAGAACTCRRAAATGTTGAGATGAGTTGATGAGTTTTATYG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4819qi9z