LOC569664

Ensembl ID:
ENSDARG00000060638
Human Orthologue:
CLSTN2
Human Description:
calsyntenin 2 [Source:HGNC Symbol;Acc:17448]
Mouse Orthologue:
Clstn2
Mouse Description:
calsyntenin 2 Gene [Source:MGI Symbol;Acc:MGI:1929897]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42616 Nonsense Mutation detected in F1 DNA During 2016
sa10780 Nonsense Available for shipment Available now
sa35982 Nonsense Mutation detected in F1 DNA During 2016
sa17939 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085676 Nonsense 226 919 5 19
Genomic Location (Zv9):
Chromosome 15 (position 40130592)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41647299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAAGCGATCGTGCACATCCATGTGAAGCCCATCTGCAAACCTGGATG[G/A]CAGGGTAAGGTTTGGACAGGTTTTTGTCTTAGATGCATATTGCAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085676 Nonsense 508 919 10 19
Genomic Location (Zv9):
Chromosome 15 (position 40166533)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41683240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAATCGAAAGCCAGAAGATCATYTCCTGCCTACAGGCCTGCAAAGAA[G/T]GACTAGACATYACATCTCTRGAAAACCTCGGACAGAGAATCAAGGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085676 Nonsense 771 919 16 19
Genomic Location (Zv9):
Chromosome 15 (position 40183771)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41700478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAGTGAGGAGGCCAGAGAACATGTCAATCATTTGATGACCCCACCC[A/T]AATCTATGCAAATTACTCATCGTACAGTCATGGAGTCTAACAACTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085676 Essential Splice Site 872 919 18 19
Genomic Location (Zv9):
Chromosome 15 (position 40185568)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41702275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGTACGACAAACCAGCCACAAAMCCAGCCAACACAAMACACAATCAW[G/A]TAAAGAAGCTGCCAAGATGTTGACACCTGTCAAACTGTCAGAGNNNNNNNNNNNNNNNNCACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis (OCB status): Oligoclonal band status in Scandinavian multiple sclerosis patients is associated with specific genetic risk alleles. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link