LOC569664

Ensembl ID:
ENSDARG00000060638
Human Orthologue:
CLSTN2
Human Description:
calsyntenin 2 [Source:HGNC Symbol;Acc:17448]
Mouse Orthologue:
Clstn2
Mouse Description:
calsyntenin 2 Gene [Source:MGI Symbol;Acc:MGI:1929897]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10780 Nonsense Available for shipment Available now
sa17939 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085676 Nonsense 508 919 10 19
Genomic Location:
Chromosome 15 (position 40166533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAATCGAAAGCCAGAAGATCATYTCCTGCCTACAGGCCTGCAAAGAA[G/T]GACTAGACATYACATCTCTRGAAAACCTCGGACAGAGAATCAAGGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085676 Essential Splice Site 872 919 18 19
Genomic Location:
Chromosome 15 (position 40185568)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGTACGACAAACCAGCCACAAAMCCAGCCAACACAAMACACAATCAW[G/A]TAAAGAAGCTGCCAAGATGTTGACACCTGTCAAACTGTCAGAGNNNNNNNNNNNNNNNNCACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis (OCB status): Oligoclonal band status in Scandinavian multiple sclerosis patients is associated with specific genetic risk alleles. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fkwjlq7e