usp16

Ensembl ID:
ENSDARG00000060633
ZFIN ID:
ZDB-GENE-030131-4153
Description:
Ubiquitin carboxyl-terminal hydrolase 16 [Source:UniProtKB/Swiss-Prot;Acc:A8HAL1]
Human Orthologue:
USP16
Human Description:
ubiquitin specific peptidase 16 [Source:HGNC Symbol;Acc:12614]
Mouse Orthologue:
Usp16
Mouse Description:
ubiquitin specific peptidase 16 Gene [Source:MGI Symbol;Acc:MGI:1921362]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17060 Nonsense Available for shipment Available now
sa16288 Nonsense Available for shipment Available now
sa2828 Nonsense Mutation detected in F1 DNA During 2014
sa2796 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085645 Nonsense 48 815 3 17
ENSDART00000134075 Nonsense 48 113 3 4

The following transcripts of ENSDARG00000060633 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 39833620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGMACAGCGTACTGAAGAAAGCCTGWCTGAATRAGCACTGGAGCTCCTG[T/A]CAAGACTGTGAGCAGGACAAGMCTGAAGAAAAGCAGATCTTAGAGGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085645 Nonsense 195 815 6 17
ENSDART00000134075 None None 113 None 4

The following transcripts of ENSDARG00000060633 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 39829669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGAAGCAGAAGAGCAGYTYGAAACAAGAGGACAGTYCTAAMAGCCAK[C/T]AATCAGCCGCCGCTGGAAGCTCAGYTGTGGTGTCTGTCAGGGGTCTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085645 Nonsense 268 815 8 17
ENSDART00000134075 None None 113 None 4

The following transcripts of ENSDARG00000060633 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 39829276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATCRTGTTTTCAGGATCCTCTTCAGATCCAGCTGGAAAGGCCTGGAT[C/A]GCTCACTCTGGCTATGTGTCAGCTAATGAATGAAATCCAAGAGACCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2796
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085645 Nonsense 452 815 12 17
ENSDART00000134075 None None 113 None 4

The following transcripts of ENSDARG00000060633 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 39825776)
KASP Assay ID:
554-2747.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGAATGAAGACATGCCTACAGGAACAGGAAGCAAATATCAGCAGAAG[A/T]AAGCCAAAAAACAGGCCAAGAAACAAGCCAAGGTAAAACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/geuigk60